The main difference between the 3 formats relates to the sequences of the oligo tags and their downstream compatibility with single-cell sequencing platforms. What is the difference between TotalSeq™-A, -B, and –C? CITE-seq and REAP-seq are two similar workflows for simultaneous protein and mRNA analysis, and the TotalSeq™ conjugates integrate seamlessly into these established protocols. TotalSeq™ is BioLegend’s brand of antibody-oligonucleotide conjugates, to enable simultaneous analysis of proteins and mRNA in single cells. What are TotalSeq™ reagents and how do they work with established workflows (CITE-seq, and REAP-seq)? (PubMed link indicates BioLegend citation) View more applications data for this product in our Scientific Poster Library. B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation. The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). Please contact technical support for more information, or visit /totalseq. 10x Genomics Chromium System and Reagents) and sequencer (e.g. TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.Īdditional reported applications (for the relevant formats) include: immunoprecipitation 1,2, complement-dependent cytotoxicity 3, in vivo depletion 4,5,9,10, mediation of in vitro redirected lysis 6, blocking of NK cell function 7, induction of proliferation 8, immunohistochemical staining of frozen sections 11, immunofluorescence microscopy 11, and spatial biology (IBEX) 16,17. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.īuyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products.
For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8☌ for 10 minutes. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions. Do not freeze.Įach lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. The antibody solution should be stored undiluted between 2☌ and 8☌. The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA. NK-1 + cells from mouse spleen and bone marrow
0 kommentar(er)
